Skip to main content

Table 3 List of PCR primers used in the cloning of the plasmids constructed in this study

From: A framework and model system to investigate linear system behavior in Escherichia coli

Primer Sequence
lacZ_1_F tattatctcgagtacctaggggtaacagtttctttatgg
lacZ_1_R tattattctagattcgctggtcacttcgatggtttg
cat_wt_F tattattctagagacgtcgaataaatacctgtgacggaag
cat_wt_R tattaagagctcaggcctaataactgccttaaaaaaattacg
cat_orf_F tattatggtacctttcaggagctaaggaagctaaaatg
cat_orf_R taataaacgcgtccaataactgccttaaaaaaattacg
PL_F tattatgacgtctccctatcagtgatagagattgacatc
lacZ_2_F tattaacctaggaggatccatgttgccactcgc
lacZ_2_R taataagacgtcatcggtcagacgattcattg
gfp_F tattatggtaccgcatgcgtaaaggagaagaacttttcactggagttgtcc
gfp_R taataaaagcttattaaactgatgcagcgtagttttcgtcgtttgctgcaggccttttg
gfp_2_R tattaagagctcgaagtgcttcaagcttattaaactgatgcagcgtag