Figure 1

Alignment of selected promoters and their flanking sequences. The reporter construct of R40 promoter (i.e. BBa_R0040) is used as a reference sequence; gap (hyphen ‘-’) and identical base (asterisk ‘*’) are indicated for the each promoter. ‘BBp’ is the BioBrick prefix (GAATTCGCGGCCGCTTCTAGAG); ‘X’ is the TetR repressor expressing device [BBa_J23101]-[BBa_P0440] and the 8-bp BioBrick scar (TACTAGAG); ‘downstream’ sequence to the initial codon ATG of the reporter EYFP gene are the 8-bp BioBrick scar, the 10-bp ribosome binding site RBS*, the 6-bp BioBrick scar, and the 3-bp initial codon (TACTAGAG|TAGTGGAGGT|TACTAG|ATG); the tetO2 operator of the Tn10 resistance operon was placed upstream of the -35 element and in the spacer region for the two TetR-binding sites (bases shown in magenta). Core bases of each operator for the TetR binding are underlined. The R40-derived promoters L01 to L16, L21 and L22 are compared in Table 1. The lacO1 operator of the P_trc1O promoter contains the bases shown in cyan. The rnpB promoter is aligned with the -10 element CACACT [25] and Z is the remaining 153 bases.