Skip to main content

Table 2 Primer sequences for real time-PCR

From: CD24 identifies nucleus pulposus progenitors/notochordal cells for disc regeneration

Gene   Primer sequence(5′- 3′)
BRACHYURY FORWARD CTGCAGTACCGAGTGGATCA
REVERSE ACAGCTCGCTCTCTTCCAGA
GLUT-1 FORWARD ACGGTGCTGCTGGTACTCTT
REVERSE TCAGGTGTCTTGTCGCTCTG
SHH FORWARD ATGAACCAGTGGCCTGGA
REVERSE CCTGTCAGACGTGGTGATGT
KRT-8 FORWARD CAGGAGCTGATGAACGTCAA
REVERSE TTCGTGTGGATGCTCATGTT
KRT-18 FORWARD GCTGAGACCACACTCTTGGAG
REVERSE TGTATCTGGCCTCCACTTCC
NOTCH1 FORWARD TCGTGCTCCTGTTCTTTGTG
REVERSE TTCTCTCCGCTTCTTCTTGC
JAGGED-1 FORWARD CTGAGGACTACGAGGGCAAG
REVERSE CCCTTCAGGAGTATCGTTGG
HES-1 FORWARD CCCGTCTACCTCTCTCCTTG
REVERSE TCCCCTTTACTTGGCTTTCA
HIF-1α FORWARD TCAAGTCAGCAACGTGGAAG
REVERSE TTCACAAATCAGCACCAAGC
RUNX2 FORWARD CCACCACTCACTACCACACG
REVERSE GGACGCTGACGAAGTACCAT
OSTEOCALCIN FORWARD CCTGACTGCATTCTGCCTCT
REVERSE AGGTAGCGCCGGAGTCTATT
BMP-2 FORWARD GAAGCCAGGTGTCTCCAAGA
REVERSE GGATGTCCTTTACCGTCGTG
ALP FORWARD GACAAGAAGCCCTTCACAGC
REVERSE ACTGGGCCTGGTAGTTGTTG
ADIPONECTIN FORWARD ACCCAAGGAAACTTGTGCAG
REVERSE CGTCTCCCTTCTCTCCCTTC
C/EBPα FORWARD GCCAAGAAGTCGGTGGATAA
REVERSE AACACCTTCTGCTGCGTCTC
PPAR-γ FORWARD CGAGAAGGAGAAGCTGTTGG
REVERSE TCAGCGGGAAGGACTTTATG
LPL FORWARD CAGCTGGGCCTAACTTTGAG
REVERSE GGATCCCAATACTTCGACCA
SOX-9 FORWARD TCAACGGCTCCAGCAAGAACAAG
REVERSE CTCCGCCTCCTCCACGAAGG
COL-II FORWARD CTCAAGTCGCTGAACAACCA
REVERSE GTCTCCGCTCTTCCACTCTG
β-ACTIN FORWARD ACGGGAATGTGAAGATGACC
REVERSE CTCTGACACCACAGGAGCAA