Skip to main content

Table 3 List of DNA oligo nucleotide primers used in the cloning of genes

From: Systematic analysis of the effects of different nitrogen source and ICDH knockout on glycolate synthesis in Escherichia coli

Primer name Sequence(5′-3′)
pAY-F CGAATTCCAACGCTTTTCGGGAGTCAGTAT
pAY-R CGGGATCCTTAGAACTGCGATTCTTCAGTGG
pargT-F CATGCCATGGATGAAGAAGTCGATTCTCGCTCT
pargT-R CGGGATCCTCAGTCACCGTAGACATTAAAGT
picd-F GGCAGACGAGCAAACCAGTAGCGCTCGAAGGAGAGGTGAGTGTAGGCTGGAGCTGCTTC
picd-R GCGTTACGCTCCCGTTAATAAATTTAACAAACTACGGCAATGGGAATTAGCCATGGTCC
veri-icd-F AACATCGTAGGGTTTATTGAACAGGA
veri-icd-R GAGCGGGTGTAAGGAGTGGTAAT
  1. “____” indicates the cleavage site of restriction endonuclease