Skip to main content

Table 2 Real-time quantitative PCR primer sequences used in this study

From: Expression profile analysis of long non-coding RNA in skeletal muscle of osteoporosis by microarray and bioinformatics

Probe Name Forward primers (5′-3′) Reverse primers (5′-3′) Amplicon size (bp)
CUST_39447_PI430048170 GTTCCCGAGGTGTCCGA TCGTTAGTCGAGCTGAAACC 148
CUST_44695_PI430048170 CGGTGAGGTAGAAGGAGAAC TCTTCCTCAGCAGCACTTCC 159
CUST_73298_PI430048170 AATCCTTGGCATTGTCTGTAA AGCCAGTAGACGACACCAGC 149
CUST_108340_PI430048170 GAACAAAGGAGCAACAGCCC CCTGATAGGAATCTGCGAAAA 83
CUST_118927_PI430048170 GAGGCTGGAATGCGGAGT CACCTACTTTCCCTTGGCTATT 160