Skip to main content

Table 1 Sequences of primers used for QRT-PCR

From: A novel egg-shell membrane based hybrid nanofibrous scaffold for cutaneous tissue engineering

Gene Sequence
Forward Reverse
IVL CCTTACTGTGAGTCTGGTTGAC TGTTTCATTTGCTCCTGATG
KRT-14 CCGCACCAAGTATGAGACAG TCAGGCTCTCAATCTGCATC
KRT-5 CCGTGCCGCAGTTCTATATT ACTTTGGGTTCTCGTGTCAG
GAPDH GGTGTGAACCATGAGAAGTATGA GAGTCCTTCCACGATACCAAAG