Skip to main content

Table 1 List of Primers

From: Alginate/Pluronic F127-based encapsulation supports viability and functionality of human dental pulp stem cell-derived insulin-producing cells

Genes Accession number Forward Primer Reverse Primer Length (bp) Tm(°C)
NANOG NM_024865.4 5′ – ATGCCTCACACGGAGACTGT – 3′
5′ – AAGTGGGTTGTTTGCCTTTG – 3′
103 61.19
57.31
OCT-4 NM_002701.6 5′ – TCGAGAACCGAGTGAGAGG – 3′
5′ – GAACCACACTCGGACCACA – 3′
125 58.14
59.56
REX-1 NM_174900.5 5′ – TGGGAAAGCGTTCGTTGAGA − 3′
5′ – CACCCTTCAAAAGTGCACCG – 3′
90 59.89
59.97
Ki67 NM_001145966.1 5′ – TCAGAATGGAAGGAAGTCAACTG – 3′
5′ – TCACTCTCATCAGGGTCAGAAG – 3’
105 58.35
58.90
PDX-1 NM_000209.4 5’ – AAGCTCACGCGTGGAAAGG – 3′
5′ – GGCCGTGAGATGTACTTGTTG – 3’
145 57.89
52.38
NGN-3 NM_020999.3 5’ – CGGTAGAAAGGATGACGCCT – 3′
5′ – GGTCACTTCGTCTTCCGAGG – 3’
138 59.54
60.11
NKX-6.1 NM_006168.2 5’ – TTGGCCTATTCGTTGGGGAT – 3′
5′ – GTCTCCGAGTCCTGCTTCTTC – 3’
125 59.08
60.14
MAFA NM_201589.3 5’ – GCACATTCTGGAGAGCGAGA – 3′
5′ – TTCTCCTTGTACAGGTCCCG – 3’
102 59.83
58.74
ISL-1 NM_002202.2 5’ – TCCCTATGTGTTGGTTGCGG - 3′
5′ – TTGGCGCATTTGATCCCGTA – 3’
200 60.32
60.39
GLUT-2 NM_000340.1 5’ – GGTTTGTAACTTATGCCTAAG – 3′
5′ – GCCTAGTTATGCATTGCAG – 3’
211 52.25
54.24
INSULIN NM_000207.2 5’ – CCGCAGCCTTTGTGAACCAACA – 3′
5′ – TTCCACAATGCCACGCTTCTGC – 3’
215 64.34
64.45
GLP-1R NM_002062.4 5’ – TCGCTGTGAAAATGAGGAGGA – 3′
5′ – TCACTCCCGCTCTGTGTTTG – 3’
189 59.38
60.25
GLUCAGON NM_002054.4 5’ – TTATTTGGAAGGCCAAGCTGC – 3′
5′ – GTCTGCGGCCAAGTTCTTCA – 3’
110 59.45
60.88
18S NR_003286.2 5’ – GTGATGCCCTTAGATGTCC – 3′
5′ – CCATCCAATCGGTAGTAGC – 3’
233 55.04
54.86