Skip to main content

Table 1 The list of primers used for the gene expression analysis

From: Alginate-chitosan core-shell microcapsule cultures of hepatic cells in a small scale stirred bioreactor: impact of shear forces and microcapsule core composition

Gene Forward primer Reverse primer
Albumin TCAAGTGTGCCAGTCTCCAAA GTCATCAGCACATTCAAGCAGA
P450 CTTCATCTACTGGCTCACCCC TCTTCCGCACCTTCTCATCCT
GAPDH AGCCAAAAGGGTCATCATCTCT AGTCCTTCCACGATACCAAAGT