Skip to main content

Advertisement

Table 4 List of real-time qPCR primers used in this study

From: A framework and model system to investigate linear system behavior in Escherichia coli

Primer Sequence Reference
qpcr_nptII_F gcgttggctacccgtgatat [48]
qpcr_nptII_R aggaagcggtcagcccat [48]
qpcr_cat_F cgcaaggcgacaaggtg [49]
qpcr_cat_R ccatcacaaacggcatgatg [49]
qpcr_gfp_F aagcgttcaactagcagacc [30]
qpcr_gfp_R aaagggcagattgtgtggac [30]
qpcr_16S_F ccggattggagtctgcaact [24]
qpcr_16S_R gtggcattctgatccacgattac [24]