Skip to main content

Table 2 Primers used in RT-PCR reactions

From: Inactivation of uptake hydrogenase leads to enhanced and sustained hydrogen production with high nitrogenase activity under high light exposure in the cyanobacterium Anabaena siamensis TISTR 8012

Primer Sequence 5 to 3 Target of primer pair PCR product, bp
ASnifDF1 tcgtattcggtggtgacaaa nifD 204
ASnifDR1 gagacacaccacggaaacct   
AShoxHF1 gaatccgtctgcgtcaattt hoxH 284
AShoxHR1 gcaaatgtccgtcgtaggtt   
23F gctaagcgatgtaccgaagc 23S rDNA 200
23R taacccagagtggacgaacc   
PsaAF1 ctgttgaaaggtgtattgtt psaA 489
PsaAR1 aggagctaccttcagtttat   
PsbAF1 gcacattcaactttatgatt psbA 390
PsbAR1 ccaaaattgagttattgaag   
FdxHF1 atggctagctaccaagttag fdxH 299
FdxHR1 ttaagcaaggtacggttctt   
CoxAF1 gcgagattacttcagtttta coxA 426
CoxAR1 atccaaataccttctcctac   
NtcAF1 cgagtctactttcttttgaa ntcA 354
NtcAR1 aaaatcacgacagagaatta   
HetRF ggatgaccggacatttgcac hetR 321
HetRR ccataagcgatcgcaagagg