Skip to main content

Table 1 Promoter DNA sequences

From: Design and analysis of LacI-repressed promoters and DNA-looping in a cyanobacterium

Promoter name Sequence 5′ to 3′
BBa_J23100 TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC
BBa_J23101 TTTACAGCTAGCTCAGTCCTAGGTATTATGCTAGC
BBa_J23102 TTGACAGCTAGCTCAGTCCTAGGTACTGTGCTAGC
BBa_J23105 TTTACGGCTAGCTCAGTCCTAGGTACTATGCTAGC
BBa_J23106 TTTACGGCTAGCTCAGTCCTAGGTATAGTGCTAGC
BBa_J23109 TTTACAGCTAGCTCAGTCCTAGGGACTGTGCTAGC
BBa_J23113 CTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGC
BBa_J23114 TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGC
PnirA CAAGCTCAGAATGCTGCGGGGAGAAGGGCAACTCCCCACCAGCCCCAAATTTTTGCTGGCGATAAATATTTTTCGGTTTAATTGTTCACAAAGCTTTTTGAATTTGAGTTTATAGAAATTTATTGGCTGGTAATGCTTTTTTGCCCCCCTGCTGGACTTCATTGATCCTTGCCTATACCATCAATATCATTGGTCAATAATGATGATGATTGACTAAAACATGTTTAACAAAATTTAACGCATATGCTAAATGCGTAAACTGCATATGCCTTGGCTGAGTGTAATTTACGTTACAAATTTTAACGAAACGGGAACCCTATATTGATCTCTACTGTTATCTGGCT
PpetE TCATAGCGGTTGCCCAATCTAACTCAGGGAGCGACTTCAGCCCACAAAAAACACCACTGGGCCTACTGGGCTATTCCCATTATCATCTACATTGAAGGGATAGCAAGCTAATTTTTATGACGGCGATCGCCAAAAACAAAGAAAATTCAGCAATTACCGTGGGTAGCAAAAAATCCCCATCTAAAGTTCAGTAAATATAGCTAGAACAACCAAGCATTTTCGGCAAAGTACTATTCAGATAGAACGAGAAATGAGCTTGTTCTATCCGCCCGGGGCTGAGGCTGTATAATCTACGACGGGCTGTCAAACATTGTGATACCATGGGCAGAAGAAAGGAAAAACGTCCCTGATCGCCTTTTTGGGCACGGAGTAGGGCGTTACCCCGGCCCGTTCAACCACAAGTCCCTATAGATACAATCGCCAAGAAGT
PrnpB TTCAATGCGGTCCAATACCTCCCCTGCCCAACTGGGTAAGCTCGCGGCTCCACTGAGTAATACAGACAAGGCTAAACAGGCAAATTTTTTCATTGGTCAACTCCTAGCACCAATTTCCCAAGACTACGGAGGGGGCAATGAAGTTTCAATTAATTGGGGTCACAAACCACAGCGGCCTATGGCTCTAATCAATGGCACACTAGAAAAA
Ptrc 2O-(−2) AATTGTGAGCGCTCACAATTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-(−1) AATTGTGAGCGCTCACAATTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-0 AATTGTGAGCGCTCACAATTTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-1 AATTGTGAGCGCTCACAATTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-2 AATTGTGAGCGCTCACAATTTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-3 AATTGTGAGCGCTCACAATTCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-4 AATTGTGAGCGCTCACAATTGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-5 AATTGTGAGCGCTCACAATTAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-6 AATTGTGAGCGCTCACAATTGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-7 AATTGTGAGCGCTCACAATTTGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-8 AATTGTGAGCGCTCACAATTATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-9 AATTGTGAGCGCTCACAATTAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-10 AATTGTGAGCGCTCACAATTAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-11 AATTGTGAGCGCTCACAATTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-12 AATTGTGAGCGCTCACAATTTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-13 AATTGTGAGCGCTCACAATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-14 AATTGTGAGCGCTCACAATTTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-15 AATTGTGAGCGCTCACAATTTTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-16 AATTGTGAGCGCTCACAATTATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-17 AATTGTGAGCGCTCACAATTTATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-18 AATTGTGAGCGCTCACAATTATATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-19 AATTGTGAGCGCTCACAATTAATATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-20 AATTGTGAGCGCTCACAATTAAATATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-21 AATTGTGAGCGCTCACAATTCAAATATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
Ptrc 2O-orig CGAATTGTGAGCGCTCACAATTCGAACGGTTCTGGCAAATATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACA
Ptrc 1O-dist AATTGTGAGCGCTCACAATTTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATCACACA
Ptrc 1O-core AAATATTCTGAAATGAGCTGTTGACAATTGTGAGCGCTCACAATATAATGTGTGGAATCACACA
Ptrc 1O-prox CGAACGGTTCTGGCAAATATTCTGAAATGAGCTGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTCACACA
PA1lacO-1 AAAGAGTGTTGACTTGTGAGCGGATAACAATGATACTTAGATTCAATTGTGAGCGGATAACAATTTCACACA
PtrcOs-prox-8 TTGACAATTAATCATCCGGCTCGTATAATGTGTAATTGTGAGCGCTCACAATT
PtrcOs-prox-9 TTGACAATTAATCATCCGGCTCGTATAATGTGTGAATTGTGAGCGCTCACAATT
PtrcOs-prox-10 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATT
PtrcOs-prox-11 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAAATTGTGAGCGCTCACAATT
PtrcOs-prox-12 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGAATTGTGAGCGCTCACAATT
PtrcOs-prox-13 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTAATTGTGAGCGCTCACAATT
PtrcOs-prox-14 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCAATTGTGAGCGCTCACAATT
PtrcOs-prox-15 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGAATTGTGAGCGCTCACAATT
PtrcOs-prox-16 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTAATTGTGAGCGCTCACAATT
PtrcOs-prox-17 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTCAATTGTGAGCGCTCACAATT
PtrcOs-prox-18 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTCCAATTGTGAGCGCTCACAATT
PtrcOs-prox-20 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTCCAGAATTGTGAGCGCTCACAATT
PtrcOs-prox-22 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTCCAGACAATTGTGAGCGCTCACAATT
PtrcOs-prox-24 TTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTCCAGACTCAATTGTGAGCGCTCACAATT