Skip to main content

Table 2 Primer DNA sequences

From: Design and analysis of LacI-repressed promoters and DNA-looping in a cyanobacterium

Primer name Sequence 5′ to 3′
VF2 (BBa_G00100) TGCCACCTGACGTCTAAGAA
VR (BBa_G00101) ATTACCGCCTTTGAGTGAGC
RBS*-EYFP-BB-f1 CTTTCTAGAGTAGTGGAGGTTACTAGATGGTGAGCAAGGGCG
B0015-BB-r1 GAACTGCAGCGGCCGCTACTAGTATATAAACGCAGAAAGGCCC
j5_00029 GCGGCCGCTGCAGCCCGTAGAAAAGATCAAAGGATCTTCTTGAGA
j5_00030 GCCACGTAGGGGTCTCTAGAAGCGGCCGCGAATTCATGTGAGCAAAAGGCCAGCA
j5_00031 GCCGCTTCTAGAGACCCCTACGTGGCCGGCAATGGTCC
j5_00032 GGTGAAACTGACCGAACATAGGAGACTTTGGTGGGCTGGCCG
j5_00033 CCACCAAAGTCTCCTATGTTCGGTCAGTTTCACCTGATTTACG
j5_00079 CTGGTTTCACATTCACCATGATCAAACCTCCACTACTCTAGTAGCTAGCATTGTACCTAGGACTGAGCTAGCCATAAAGACAGTCATTCATCTTTCTGCCCCTCC
j5_00042 GTAGTGGAGGTTTGATCATGGTGAATGTGAAACCAGTAACGTTATACGATG
j5_00072 GTTCGTTAAGGCTTGATCTCTATTATTACTGCCCGCTTTCCAGTCGG
j5_00073 GGAAAGCGGGCAGTAATAATAGAGATCAAGCCTTAACGAACTAAGACCCC
j5_00088 CCCGATCAACTCGTGTCTGCTCCTCGGTTATGTTTTTAAGGTC
j5_00090 CGAGGAGCAGACACGAGTTGATCGGGCACGTAAGAGG
j5_00092 GCCATCCACTTCCTTGGTCTGACAGCTCGAGGCTTGG
j5_00093 GCTGTCAGACCAAGGAAGTGGATGGCCCCGTATTGC
j5_00039 CTTTGATCTTTTCTACGGGCTGCAGCGGCCGCTACTAGTAGGTCCCAAGTTTGTGCTGTGGC
slr0168-UR-f2 AAAGGGGACGAAGCCGCAGTTC
slr0168-DR-r2 ATCGCCGTGGTTAAATCCGTGG
P2OLib-r TGAGCTACTAGTATGTGTGAAATTGTGAGCGCTCACAATTCCAC
P2OLib-f1O TCAGAATTCGCGGCCGCTTCTAGAGCGAACGGTTCTGGCAAATATTC
P2OLib-f-2 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTGACAATTAATCATCCGGCTCG
P2OLib-f-1 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTTGACAATTAATCATCCGGCTCG
P2OLib-f0 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTTTGACAATTAATCATCCGGCTC
P2OLib-f1 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTGTTGACAATTAATCATCCGGC
P2OLib-f2 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTTGTTGACAATTAATCATCCGG
P2OLib-f3 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTCTGTTGACAATTAATCATCCGG
P2OLib-f4 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTGCTGTTGACAATTAATCATCCGG
P2OLib-f5 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTAGCTGTTGACAATTAATCATCCG
P2OLib-f6 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTGAGCTGTTGACAATTAATCATCCG
P2OLib-f7 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTTGAGCTGTTGACAATTAATCATCC
P2OLib-f8 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTATGAGCTGTTGACAATTAATCATCC
P2OLib-f9 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTAATGAGCTGTTGACAATTAATCATCC
P2OLib-f10 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTAAATGAGCTGTTGACAATTAATCATC
P2OLib-f11 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTGAAATGAGCTGTTGACAATTAATCATC
P2OLib-f12 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTTGAAATGAGCTGTTGACAATTAATC
P2OLib-f13 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTCTGAAATGAGCTGTTGACAATTAATC
P2OLib-f14 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTTCTGAAATGAGCTGTTGACAATTAATC
P2OLib-f15 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTTTCTGAAATGAGCTGTTGACAATTA
P2OLib-f16 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTATTCTGAAATGAGCTGTTGACAATT
P2OLib-f17 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTTATTCTGAAATGAGCTGTTGACAATT
P2OLib-f18 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTATATTCTGAAATGAGCTGTTGACAATT
P2OLib-f19 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTAATATTCTGAAATGAGCTGTTGACAA
P2OLib-f20 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTAAATATTCTGAAATGAGCTGTTGACA
P2OLib-f21 TCAGAATTCGCGGCCGCTTCTAGAGAATTGTGAGCGCTCACAATTCAAATATTCTGAAATGAGCTGTTGAC
P1Od-f1 AAGTCTAGAGAATTGTGAGCGCTCACAATTTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATCACACATACTAGAGTAGTGGAGGTTACTAGATGG
P1Oc-f1 AAGTCTAGAGAAATATTCTGAAATGAGCTGTTGACAATTGTGAGCGCTCACAATATAATGTGTGGAATCACACATACTAGAGTAGTGGAGGTTACTAGATGG
PA1lacO1-FP-f1 AAGTCTAGAGAAAGAGTGTTGACTTGTGAGCGGATAACAATGATACTTAGATTCAATTGTGAGCGGATAACAATTTCACACATACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-8-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-9-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-10-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-11-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-12-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-13-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-14-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-15-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-16-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-17-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTCAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-18-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTCCAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-20-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTCCAGAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-22-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTCCAGACAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG
PtrcOs-prox-24-f1 TTCTCTAGAGTTGACAATTAATCATCCGGCTCGTATAATGTGTGGAGTCGTCCAGACTCAATTGTGAGCGCTCACAATTTACTAGAGTAGTGGAGGTTACTAGATGG