Skip to main content

Table 1 Primers used for site-directed mutagenesis

From: Analysis of the stability and affinity of BlaR-CTD protein to β-lactam antibiotics based on docking and mutagenesis studies

Mutation site Primers Sequence 5′-3′
A138E F CATCCAGCCAATAATTCTCCGGACCTGAGAAATCC
R GGATTTCTCAGGTCCGGAGAATTATTGGCTGGATG
Q147K F GAGGGGAAATTTTAAGAGAGCC
R GGCTCTCTTAAAATTTCCCCTC
I188K F GTCCCGGTTTTACCGGATAGTTTTCTGCCATTTGATTCTTCT
R AGAAGAATCAAATGGCAGAAAACTATCCGGTAAAACCGGGAC
S190Y F AAGTCCCGGTTTTACCGTATAG
R TCTATACGGTAAAACCGGGAC
V197D F CTCCGTTGATATCTGAAGTCC
R GGGACTTCAGATATCAACGG
S19C/G24C
 S19C F GATGACTGCACCTTTTTTGATGGCT
R GGTGCAGTCATCTTCGTATTCTACA
 G24C F TTTGATTGCTTCTCAGGAGGTTTTG
R AGAAGCAATCAAAAAAGGTGCAGTC
R50C/Q147C
 R50C F CCGCCTGTTTCGCACCTGCTTCTAC
R GCGAAACAGGCGGTGCTTTCTTTCC
 Q147C F TCTCTTTGTATTTCCCCTCTTGAAC
R GAAATACAAAGAGAGCCATCCAGCC
S76C/ L96C
 S76C F CAATTGTCAAATGACGTGGGACGGA
R CATTTGACAATTGTTCTTCGTGATGATCCC
 L96C F AGGATTGTTTCTCTGCGATGAGCAG
R GCAGAGAAACAATCCTGGTCTTGAT
S135C/S145C
 S135C F ATTTCTGTGGTCCGGCGAATTATTG
R CGGACCACAGAAATCCTCATTTCCA
 S145C F GATGGCTGTCTTCAAATTTCCCCTC
R TGAAGACAGCCATCCAGCCAATAAT
E183C/ I188C
 E183C F TTAGAATGCTCAAATGGCAGAATTC
R TTGAGCATTCTAAACGTATCGAATC
 I188C F GGCAGATGTCTATCCGGTAAAACC
R ATAGACATCTGCCATTTGAGCATTC
  1. Notes: The underline shows the bases corresponding to the mutant amino acids