Skip to main content

Table 1 Sequences and primers for the cloning and expression of genes for the proteins pet28a-Hapo, pet28a-T, pet28a-P, pet28a-L, pet28a-LplA, and pETduet-H-LplA

From: Quantitative study of H protein lipoylation of the glycine cleavage system and a strategy to increase its activity by co-expression of LplA

Primer Oligonucleotide Sequence Restriction Site NCBI NO.
ecH-fwd CATGCCATGGGCAGCAACGTACCAGCAGAACTGAAATAC NcoI WP_001295377.1
ecH-rev CCGCTCGAGCTCGTCTTCTAACAATGCTTCGTATGC XhoI
ecT-fwd CATGCCATGGCACAACAGACTCCTTTGTACGAACAA NcoI WP_099356926.1
ecT-rev CCGCTCGAGCGCGACGGCTTTGCCGTTACGCACAAAAAC XhoI
ecP-fwd CATGCCATGGGCACACAGACGTTAAGCCAGCTTGAAAAC NcoI WP_112929453.1
ecP-rev CCGCTCGAGCTGGTATTCGCTAATCGGTACGCAGGAGCAG XhoI
ecL-fwd CCGCTCGAGTTACTTCTTCTTCGCTTTCGGGTTC XhoI WP_110826218.1
ecL-rev GGGAATTCCATATGATGAGTACTGAAATCAAAACTCAGGTCG NdeI
ecLplA-fwd CCATGGGCTCCACATTACGCCTGCTCATCTCT NcoI WP_000105885.1
ecLplA-rev CTCGAGCTACCTTACAGCCCCCGCCAT XhoI
pETduet-ecH-LplA   
 H-fwd CATGCCATGGGCAGCAACGTACC NcoI  
 H-rev CCCAAGCTTGGCTTTGTTAGCAGCCGGATC HindIII
 vector-fwd GGCCACGCGATCGCTG Infusion
 vector-rev TATCCAATTGAGATCTGCCATATGTATATCTCCTTCTTAT
 Fragement-fwd GATCTCAATTGGATAATGGGCTCCACATTACGCC
 Fragement-rev AGCGATCGCGTGGCCCTACCTTACAGCCCCCGC