Skip to main content

Table 1 RT-qPCR primer sequences

From: Long non-coding RNA PVT1 knockdown suppresses fibroblast-like synoviocyte inflammation and induces apoptosis in rheumatoid arthritis through demethylation of sirt6

Gene Sequences (5′ - 3′)
LncRNA PVT1 F: TGGTACCGAGCTCGGATCCTCAAGATGGCTGTGCC
R: CCGCCACTGTGCTGGATGATAGAAAAAGAATTTAATAG
sirt6 F: GCCGTCTGGTCATTGTCA
R: AGCCTTGGGTGCTACTGG
Ki67 F: ACCTACCTTCAACGCTCTCTGA
R: TCCGCTTACTTCTGGACAATCT
PCNA F: ACCGCTGCGATCGCAACCTG
R: GGCATGTTTACTACGCAGCTG
Bax F: ATGCGTCCACCAAGAAGC
R: CAGTTGAAGTTGCCATCAGC
Bcl-2 F: GACTGAGTACCTGAACCGGCATC
R: CTGAGCAGCGTCTTCAGAGACA
caspase-3 F: AAGCGTGCCAACGACAGCTGTGGGAC
R: TTAATAGTCATCATATTGACACTGGC
GAPDH F: TTGGTATCGTGGAAGGACTCA
R: TGTCATCATATTTGGCAGGTT
  1. Note: RT-qPCR, reverse transcription quantitative polymerase chain reaction; LncRNA PVT1, long non-coding RNA plasmacytoma variant translocation 1; Sirt6, sirtuin 6; PCNA, proliferating cell nuclear antigen; Bcl-2, B-cell lymphoma/leukemia 2; Bax, Bcl-2-associated X protein; casp-3, caspase-3; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse