Skip to main content

Table 2 MSP primer sequences

From: Long non-coding RNA PVT1 knockdown suppresses fibroblast-like synoviocyte inflammation and induces apoptosis in rheumatoid arthritis through demethylation of sirt6

Gene Sequences (5′ - 3′)
sirt6-methylation F: GTGTAACGGAGTAAGGGATGTTAC
R: ACTAAACCCATATAAATTCACCGAA
sirt6-unmethylation F: TGTGTAATGGAGTAAGGGATGTTAT
R: ACTAAACCCATATAAATTCACCAAA
  1. Note: MSP, methylation specific polymerase chain reaction; Sirt6, sirtuin 6; F, forward; R, reverse