Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Exosomes derived from microRNA-138-5p-overexpressing bone marrow-derived mesenchymal stem cells confer neuroprotection to astrocytes following ischemic stroke via inhibition of LCN2

Gene Sequences (5′-3′)
miR-138-5p F: GCCGGATAAGTGTTGTGGTCGA R: ACTGAGCAAGCACTACCACCAGCA
LCN2 F: TGCCACTCCATCTTTCCTGTT R: GGGAGTGCTGGCCAAATAAG
GAPDH F: TTCACCACCATGGAGAAGGC R: GGCATGGACTGTGGTCATGA
Caspase-3 F: TGTCATCTCGCTCTGGTACG R: AAATGACCCCTTCATCACCA
Bax F: TGCAGAGGATGATGCTGAC R: CCTGTGACCTGAAGGAGG
Bcl-2 F: CCTGTGCCACCATGTGTCCATCC R: GCTGAGAACAGGGTCTTCAGAGAC
U6 F: CTCGCTTCGGCAGCACA R: AACGCTTCACGAATTTGCGT
IL-6 F: CCACTTCACAAGTCGGAGGCTT R: CCAGCTTATCTGTTAGGAGA
IL-1β F: GAAACAGCAATGGTCGGGAC R: AAGACACGGGTTCCATGGTG
TNF-α F: CGGAGTCCGGGCAGGT R: GCTGGGTAGAGAATGGATGAACA
  1. Note: RT-qPCR, reverse transcription quantitative polymerase chain reaction; F, forward; R, reverse; miR-138-5p, microRNA-138-5p; LCN2, lipocalin 2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Bax, Bcl-2-associated X protein; Bcl-2, B-cell CLL/Lymphoma 2; IL-6, interleukin-6; IL-1β, interleukin-1β; TNF-α, tumor necrosis factor-α