Gene | Sequence (5' to 3') | Product (bp) | Application |
---|---|---|---|
 | F: CACCGgttggatgggagagaagact R: AAACagtcttctctcccatccaacc | - | Silencer-gRNA (Targeting silencer) |
F: CACCGattgaaactaaaatctaacc R: AAACggttagattttagtttcaatc | - | CAR-gRNA (Targeting CAR) | |
P1: caccgtcctgatggattagcagaac P2: cccagaattaaaaactaatatttgctctcc P3: caccggctctccattcaatccaaaa P4: ccatagaaatcatttaatgggattggg | (P1 and P4):140Â bp (P2 and P4):95Â bp (P3 and P4):77Â bp | RT-PCR (Detection of Non-coding RNAs) | |
Ovalbumin (J00895) and its promoter | F: CCCAAGCTTGGGTCGCG ATCGCGAcctctgctttctcatatatctgtcc R: CGGATATCCGGCCCCTTA AGGGGtagagctgacatgatggcaayg | 556 | Cloning of the left homology arm |
F: CCCAAGCTTGGGCTAGC TAGCTAggtgcaaaagacagcaccaggac R: CCGGATATCCGgtttgttctgaat cccctgttacttcc | 526 | Cloning of the right homology arm | |
F: CACCGaatgatttctatggcgtcaa R: AAACttgacgccatagaaatcattc | - | NRE-gRNA (Targeting downstream of CARa) | |
F: CACCGtaaacttcagctagtggtat R: AAACataccactagctgaagtttac | - | SDRE-gRNA (Targeting upstream of SDREb) | |
F: CACCGgctctagccatggtatacct R: AAACaggtataccatggctagagc | - | OVA E2-gRNA (Targeting Ovalbumin exon 2) | |
 | P5: aatattatttgcactaccatcttgtct P6: gtgcaagtaagagctaatatagagag P7: cacccttaaagatacaacacatagcaca | WTc (P5 and P7):1310 DELd (P5 and P7): ~ 370 WT (P5 and P6):1256 DEL (P5 and P6): ~ 316 | Genomic PCR confirmation of promoter deletion |
Ovalbumin (NM_205152) | P8: tgctgttgcctgatgaagtctc P9: aatgcccatagccattaagacaga | 179 | RT-qPCR |
GAPDH (NM_204305) | P10: cagaacatcatcccagcgtcc P11: cagcagccttcactaccctc | 187 | RT-qPCR |
Ovalbumin and Dsred2 | P12: taccttctctctatattagctctta P13: ggtgcttcacgtacaccttg |  ~ 2569 | Genomic PCR confirmation of transgene integration |